View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21408_low_38 (Length: 226)
Name: NF21408_low_38
Description: NF21408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21408_low_38 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 15 - 208
Target Start/End: Original strand, 53958346 - 53958539
Alignment:
| Q |
15 |
atgaaattagaaatttagagtatagtttaaaattggattcaccgtaggaagagccatggggctactaggctcgaattgtttcatagggttatcaagtaga |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53958346 |
atgaaattagaaatttagagtatagtttaaacttggattcaccgtaggaagagccatggggctactaggctcgaattgtttcatagggttatcaagtaga |
53958445 |
T |
 |
| Q |
115 |
acaagtgatccatgttgtggctcaggcttcagagcctgtacagcaaagttacaccaagcaagtgaaaggaaatccattgactcagggtgtgcat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
53958446 |
acaagtgatccatgttgtggctcaggcttcagagcctgtacagcaaagttacaccaagcaagtgaaaggaaatccattgagtcagggtgtgcat |
53958539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University