View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21409_high_5 (Length: 320)
Name: NF21409_high_5
Description: NF21409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21409_high_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 13 - 209
Target Start/End: Complemental strand, 45973717 - 45973521
Alignment:
| Q |
13 |
cagacggagacaatacgatccagaaggttaattattcaatgactttacgacaaagatcgaaaatggtaaagggcatgtgttgtttcgtagttgaggcaac |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45973717 |
cagacggagacaatacgatccagaaggttaattattcaatgactttacgacaaagatcgaaaatggtaaagggcatgtgttgtttcgtagttgaggcaac |
45973618 |
T |
|
| Q |
113 |
ctgcgatggtgctcagacgagttttgtcggagtcgacaaggagacacgcggcggtgtatactgtgactcttatccaccctccatcaactctgattac |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45973617 |
ctgcgatggtgctcagacgagttttgtcggagtcgacaaggagacacacggcggtgtatactgtgactcttatccaccctccatcaactctgattac |
45973521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 225 - 302
Target Start/End: Complemental strand, 45973495 - 45973417
Alignment:
| Q |
225 |
ctcaaagaacccctcactggtaaattgttaaattgtaatggaaaacaatgtaatgaattggaatcctt-atggataaaa |
302 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
45973495 |
ctcaaagaacccctcactggtaaattgataaattgtaatggaaaacaatgtaatgaattggaatccttgatggataaaa |
45973417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University