View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21409_low_9 (Length: 211)
Name: NF21409_low_9
Description: NF21409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21409_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 1 - 191
Target Start/End: Complemental strand, 24896734 - 24896541
Alignment:
| Q |
1 |
acttaaaccgcttaattacccctcataccacata---tttgttacatgtggtcttctatacaatcgtgaaacttattaattagtgtgaatataccagtct |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24896734 |
acttaaaccgcttaattacccctcataccacataatatttgttacatgtggtcttctatacaatcgtgaaacttattaattagtgtgaatataccagtct |
24896635 |
T |
|
| Q |
98 |
gaaaatgattgaagatgattattctctaaacacattcaaacaaatattaattttggcatatagtgttttagttcatacttagttgactaaacta |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24896634 |
gaaaatgattgaagatgattattctctaaacacattcaaacaaatattaattttagcatatagtgttttagttcatacttagttgactaaacta |
24896541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University