View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2140_low_18 (Length: 282)
Name: NF2140_low_18
Description: NF2140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2140_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 24 - 264
Target Start/End: Complemental strand, 53985440 - 53985201
Alignment:
| Q |
24 |
tccatttgaatcttgtgcgtttcatgtcttacgaagaatttagcaggtttttcctaggctgtcccattgtagaggagttgcaaacaagtaatgtatatgc |
123 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
53985440 |
tccatttgaatcttgtgcgtttcatgtct-acgaagaatttagcaggtttttcctaggctgtcccattctagaggagttgcaaacaagtaatgtatatgc |
53985342 |
T |
 |
| Q |
124 |
acatcatccgataacgaagattcctgggagaattcaacccttgtcccgtttggcaagagcaactatttctggaggaaacctatatattaatctcttcttg |
223 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
53985341 |
acatcctccgataacgaagattcctgggagaattcaacccttgtcccatttggcaagagcaactatttctggaggtaacctatatattaatctcttcttg |
53985242 |
T |
 |
| Q |
224 |
ctgtctgcatgtacagattctgagttataaagtggtatgat |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53985241 |
ctgtctgcatgtacagattctgagttataaagtggtatgat |
53985201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University