View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21410_high_9 (Length: 241)
Name: NF21410_high_9
Description: NF21410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21410_high_9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 32815383 - 32815597
Alignment:
| Q |
1 |
ttaacttaattgttagacactctagtctacctagattcacacccctaactaacaaacatactttgcaattcataatatcatatattggtcataaaggtta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32815383 |
ttaacttaattgttagacactctagtctacctagattcaca----------------atactttgcaattcataatatcatatattggtcataaaggtta |
32815466 |
T |
|
| Q |
101 |
ccgtcatcattcactttaaaaaatacatttcgtagtttaagttatctagtgtggttaactaacttgtcataaaaatacgtggtttaagttgttattttgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32815467 |
ccgtcatcattcactttaaaaaatacatttcgtagtttaagtgatctagtgtggttaactaacttgtcataaaaatacgtggtttaagttgttattttgt |
32815566 |
T |
|
| Q |
201 |
ggcacaattgatactatagattatgcctatg |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
32815567 |
ggcacaattgatactatagattatgcctatg |
32815597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University