View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21413_high_22 (Length: 335)
Name: NF21413_high_22
Description: NF21413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21413_high_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 300; Significance: 1e-169; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 300; E-Value: 1e-169
Query Start/End: Original strand, 1 - 320
Target Start/End: Original strand, 29847531 - 29847850
Alignment:
| Q |
1 |
ttggcatagcttcattgaagataatataacacttaattgagatgataaagtgaagccattgtggcctctagtgaacataaggatggactgacaactatta |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
29847531 |
ttggcatagcttcattgaagataacataacacttaattgagatgataaagtgaagccattgtgtcctctagtgaacataaggatggactgacaactatta |
29847630 |
T |
|
| Q |
101 |
tgtctgcttgattaaaggtggcagccctggtatgagggttactgctgctgtctaccaaacatgtcatgataccatgtcattgtttttgatcttgtctgat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29847631 |
tgtctgcttgattaaaggtggcagccctggtatgagggttactgctgctgtctaccaaacatgtcatgataccatgtcattgtttttgatcttgtctgat |
29847730 |
T |
|
| Q |
201 |
atttaaggatgtttggttgttaaggaggacaattgaaacttaagcttgcaactaactttttattggggaacatgattttaaacaacggttaaggttacga |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
29847731 |
atttaaggatgtttggttgttaaggaggacaattgaaacttaagcttgcaactaacttgttattggggaacatgattttaaaccaccgttaaggttacga |
29847830 |
T |
|
| Q |
301 |
tgcaaacttttatattgcag |
320 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
29847831 |
tgcaaacttttatattgcag |
29847850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University