View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21413_high_7 (Length: 532)
Name: NF21413_high_7
Description: NF21413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21413_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 369; Significance: 0; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 369; E-Value: 0
Query Start/End: Original strand, 132 - 520
Target Start/End: Original strand, 36604245 - 36604633
Alignment:
| Q |
132 |
aagccaatgaaaaaattaattatctctaatttatgtcactaaattaatttttatcttcttttgatctatgtatatacaaacctggtttgtgattgcggtt |
231 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
36604245 |
aagccaacgaaaaaattaattatctctaatttatgtcactaaattaatttttatcttcttttgatctatgtatatactaacctggtttgtgattgcggtt |
36604344 |
T |
 |
| Q |
232 |
attataccaatggggagagtgaagaagatagcaatgccacatgctaacagaacaccccaccaaggtaattgtagctgttcattgtaatattcacatgcaa |
331 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36604345 |
attataccaatggggagggtgaagaagatagcaatgccacatgctaacagaacaccccaccaaggtaattgtagctgttcattgtaatattcacatgcaa |
36604444 |
T |
 |
| Q |
332 |
aaatggtagttccaatggttgcaatgagtatgcacacaaaccaccactcaggaacctgtttgtacctcctcataagctttgtgtggatgtccatgctctt |
431 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36604445 |
aaatggtagttgcaatggttgcaatgagtatgcacacaaaccaccactcaggaacctgtttgtacctcctcataagctttgtgtggatgtccatgctctt |
36604544 |
T |
 |
| Q |
432 |
ttcattaaaacttgatttgctttgctcccatatttctctgttttttcaatttttccatttcatacataaattgtcccatgacatagatg |
520 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
36604545 |
ttcattaaaacttgatttgctttgctcccatatttctctgttttttcaattttcccatttcatacataaattgtcccatgacatagatg |
36604633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 7 - 137
Target Start/End: Complemental strand, 36604248 - 36604118
Alignment:
| Q |
7 |
gcttattttctaattatagagtccagggctgaacataatcacggagtacatcataggatatatctaccctggatatcctgtagctaacatgtgcttcaag |
106 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36604248 |
gcttaatttctaattatagagtccagggctgaacataatcacggagtacatcataggatatatctaccctggatatcctgtagctaacatgtgcttcaag |
36604149 |
T |
 |
| Q |
107 |
gtttatggttacattagtatgacacaagcca |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
36604148 |
gtttatggttacattagtatgacacaagcca |
36604118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University