View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21413_high_9 (Length: 522)
Name: NF21413_high_9
Description: NF21413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21413_high_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 249 - 484
Target Start/End: Original strand, 36038452 - 36038686
Alignment:
| Q |
249 |
atgaaaaggatgtctttgattccaaacttgcgttcctgtataacataagccaagccagaaggcaccaaccaggatatgtcaccatccaagacatgaaact |
348 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
36038452 |
atgaaaaggatgtctttgattccaaacttgcgttcctgtataacataagccaagccagaaggcaccaaccaggatatgtcaccatccaagacatgaa-ct |
36038550 |
T |
|
| Q |
349 |
attgtgaggtgaaattctaaaatcctctcactaattattgtcttaacaagctcaattaattgggattgtgcaacaatttctatatataatactagttgta |
448 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
36038551 |
attgtgaggtgaaattctaaaatcctctcactaattattgtcttaacaagctcaattaattgggattgtgcaaaaatttctatatataatactagttgta |
36038650 |
T |
|
| Q |
449 |
cgataccgaagatctatctacctagcttcacaggtt |
484 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |
|
|
| T |
36038651 |
cgatactgaagatctatctacctagcttcacaggtt |
36038686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 18 - 91
Target Start/End: Original strand, 36038377 - 36038450
Alignment:
| Q |
18 |
cattgtttacttcaaatcaattgtccaatgtgggtggtctcaaattctatttagagtttaaggttgatcatgat |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36038377 |
cattgtttacttcaaatcaattgtccaatgtgggtggtctcaaattctatttagagtttaaggttgatcatgat |
36038450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University