View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21413_low_33 (Length: 265)
Name: NF21413_low_33
Description: NF21413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21413_low_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 4e-90; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 53 - 232
Target Start/End: Complemental strand, 14597017 - 14596838
Alignment:
| Q |
53 |
gagaaagagtgggatggatttatgggtcagtgacagaagacgtggttacagggtaccgcatgcacaatcgtggatggcgttctgtatattgtgtaaccaa |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14597017 |
gagaaagagtgggatggatttatgggtcagtgacagaggatgtggttacagggtaccgcatgcacaatcgtggatggcgttctgtatattgtgtaaccaa |
14596918 |
T |
 |
| Q |
153 |
gcgagatgcatttcgtggatcagcaccaattaatcttactgatcgactacaccaggtgctaagatgggccacaggttctg |
232 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14596917 |
gcgagatgcatttcgtggatctgcaccaattaatcttactgatcgactacaccaggtgctaagatgggccacaggttctg |
14596838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 53 - 232
Target Start/End: Original strand, 14611553 - 14611732
Alignment:
| Q |
53 |
gagaaagagtgggatggatttatgggtcagtgacagaagacgtggttacagggtaccgcatgcacaatcgtggatggcgttctgtatattgtgtaaccaa |
152 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||| ||||| |||||||| |||||||||||||| ||||||||||||||||||||||| || ||||| |
|
|
| T |
14611553 |
gagacagagtgggatggatttatggatcagtgacagaggacgtcgttacaggttaccgcatgcacaaccgtggatggcgttctgtatattgcgtgaccaa |
14611652 |
T |
 |
| Q |
153 |
gcgagatgcatttcgtggatcagcaccaattaatcttactgatcgactacaccaggtgctaagatgggccacaggttctg |
232 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14611653 |
gcgagatgcatttcgcggatcagcaccaattaaccttactgatcgactacaccaggtgctaagatgggccacaggttctg |
14611732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University