View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21413_low_35 (Length: 250)
Name: NF21413_low_35
Description: NF21413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21413_low_35 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 99; Significance: 6e-49; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 1 - 103
Target Start/End: Complemental strand, 7003932 - 7003830
Alignment:
| Q |
1 |
catctcttgtccattctccttaaaaaatgagtaatttattacttttataattgagatttgacatcaattttattttcaacgagtacaaaaacatgcttgt |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7003932 |
catctcttgtccatcctccttaaaaaatgagtaatttattacttttataattgagatttgacatcaattttattttcaacgagtacaaaaacatgcttgt |
7003833 |
T |
 |
| Q |
101 |
gtt |
103 |
Q |
| |
|
||| |
|
|
| T |
7003832 |
gtt |
7003830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 99 - 240
Target Start/End: Complemental strand, 7003675 - 7003543
Alignment:
| Q |
99 |
gtgtttgagtcttttatcacgcagatgaaccatataacaattcactacttttctttacaatctttacaaataatgtattttggatggttacttcatgata |
198 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
7003675 |
gtgtttgaatcttttatcacgcagatagaccatataacaattcactgcttttctttacaa---------ataatgtattttggatggttacttcatgata |
7003585 |
T |
 |
| Q |
199 |
tgatgttagagctgattagatggcatattgtttaatcctttg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7003584 |
tgatgttagagctgattagatggcatattgtttaatcctttg |
7003543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University