View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21413_low_37 (Length: 248)
Name: NF21413_low_37
Description: NF21413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21413_low_37 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 4082409 - 4082180
Alignment:
| Q |
1 |
cctttcttttcttcactctctttgcctctctggacaggccaaacaagaagcgtgttctccaaatgctcattattatggcgtttaatgctttgatttcggg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
4082409 |
cctttcttttcttcactctctttgcctctctggacaggccaaacaacaagcgtgttctccaaatgctcattattatggtgcttaatgctttgatttcggg |
4082310 |
T |
 |
| Q |
101 |
attcatcgtcaaacttttgaaccatgatttcgcaaaaattgttgggtgggcgtggtcaatccctattatcttggtcctgggctttagatacaacgatgtt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4082309 |
attcatcgtcaaacttttgaaccatgatttcgcaaaaattgttgggtggacctggtcaatccctattatcttggtcctgggctttagatacaacgatgtt |
4082210 |
T |
 |
| Q |
201 |
ctcctccaactagcttcaatcggaaattcc |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
4082209 |
ctcctccaactagcttcaatcggaaattcc |
4082180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 4086558 - 4086329
Alignment:
| Q |
1 |
cctttcttttcttcactctctttgcctctctggacaggccaaacaagaagcgtgttctccaaatgctcattattatggcgtttaatgctttgatttcggg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
4086558 |
cctttcttttcttcactctctttgcctctctggacaggccaaacaacaagcgtgttctccaaatgctcattattatggtgcttaatgctttgatttcggg |
4086459 |
T |
 |
| Q |
101 |
attcatcgtcaaacttttgaaccatgatttcgcaaaaattgttgggtgggcgtggtcaatccctattatcttggtcctgggctttagatacaacgatgtt |
200 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4086458 |
attcatcgtcaaacttttgaaccatgaattcgcaaaaattgttgggtggacctggtcaatccctattatcttggtcctgggctttagatacaacgatgtt |
4086359 |
T |
 |
| Q |
201 |
ctcctccaactagcttcaatcggaaattcc |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
4086358 |
ctcctccaactagcttcaatcggaaattcc |
4086329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 4092118 - 4091889
Alignment:
| Q |
1 |
cctttcttttcttcactctctttgcctctctggacaggccaaacaagaagcgtgttctccaaatgctcattattatggcgtttaatgctttgatttcggg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
4092118 |
cctttcttttcttcactctctttgcctctctggacaggccaaacaacaagcgtgttctccaaatgctcattattatggtgcttaatgctttgatttcggg |
4092019 |
T |
 |
| Q |
101 |
attcatcgtcaaacttttgaaccatgatttcgcaaaaattgttgggtgggcgtggtcaatccctattatcttggtcctgggctttagatacaacgatgtt |
200 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||| ||||||||||||| ||||||||||| |||||| |
|
|
| T |
4092018 |
attcatcgtcaaacttttgaaccatgacttcgcaaaaattgttgggtgggcctggtcaatccctattctcttggtcctggggtttagatacaatgatgtt |
4091919 |
T |
 |
| Q |
201 |
ctcctccaactagcttcaatcggaaattcc |
230 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |
|
|
| T |
4091918 |
ctcctccaactatcttcaatcggaaattcc |
4091889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University