View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21413_low_46 (Length: 207)
Name: NF21413_low_46
Description: NF21413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21413_low_46 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 13 - 146
Target Start/End: Complemental strand, 3712283 - 3712150
Alignment:
| Q |
13 |
agcaaaggtaatataaagacaaatgaagttcaatattatttgagtatacttgcattctgcccnnnnnnnntaaaattgagtatacttgctatctagacat |
112 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
3712283 |
agcaaaggtaatataaagacaagtgaagttcaatattatttgagtatacttgcattctgcccaaaaaaaataaaattgagtatacttgcaatctagacat |
3712184 |
T |
 |
| Q |
113 |
ttaaatctttttatatattcatctaatagaacta |
146 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |
|
|
| T |
3712183 |
ttaaatctttttatatatccatctaatagaacta |
3712150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University