View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21414_high_7 (Length: 300)
Name: NF21414_high_7
Description: NF21414
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21414_high_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 1 - 295
Target Start/End: Complemental strand, 47680806 - 47680503
Alignment:
| Q |
1 |
gatcatcaatgaattgagtcaaaccctaataaacgcaattggtttgtgtctcggtttttcaaacatgatgggtggttagggtgtcacaacacaattggtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47680806 |
gatcatcaatgaattgagtcaaaccctaataaacgcaattggtttgtgtctcggtttttcaaacatgatgggtggttagggtgtcacaacacaattggtt |
47680707 |
T |
 |
| Q |
101 |
tctgtgtttaaaaattcgaatcctgtcttttccatcctt---------tagggtagccccccatgccttgctgtcactgcatgtaggtccttcattctct |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47680706 |
tctgtgtttaaaaattcgaatcctgtcttttccatccttgcttttctttagggtagccccccatgccttgctgtcactgcatgtaggtccttcattctct |
47680607 |
T |
 |
| Q |
192 |
gctacttcaaccacacatacatagatcaatcacgcgcctctctcattatgcttgcttagggatcatcttgccctaattgaacttactttgtcttctttgt |
291 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||| | |
|
|
| T |
47680606 |
gctccttcaaccacacatacatagatcaatcacgcgcctctctcattatgcttgcttagggatcatcttgccctaattgaacttaatttgtctttttttt |
47680507 |
T |
 |
| Q |
292 |
ttct |
295 |
Q |
| |
|
|||| |
|
|
| T |
47680506 |
ttct |
47680503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University