View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21416_high_12 (Length: 263)
Name: NF21416_high_12
Description: NF21416
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21416_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 190
Target Start/End: Original strand, 23715730 - 23715919
Alignment:
| Q |
1 |
agttgacaaagcagaattagcatcattgttacaaaatctgtgaataatgactagtgactatattgaagtcttgtgtctgttctagtaatttcataaggaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23715730 |
agttgacaaagcagaattagcatcattgttacaaaatctgtgaataatgactagtgactatattgaagtcttgtgtctgttctagtaatttcataaggaa |
23715829 |
T |
 |
| Q |
101 |
aatgacactttatgggcactgcccaaaaaatgtattatagtagtaagttgtaccatacatattagtgacatttaaccatattatgatccc |
190 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23715830 |
aatgacactttataggcactgcccaaaaaatgtattatagtagtaagttgtaccatacatattagtgacatttaaccatattatgatccc |
23715919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 208 - 244
Target Start/End: Original strand, 23715905 - 23715941
Alignment:
| Q |
208 |
ccatattatgatcccaagtggtgttgatagaggatga |
244 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |
|
|
| T |
23715905 |
ccatattatgatcccaagtggtgttgattgaggatga |
23715941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University