View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21416_low_10 (Length: 331)
Name: NF21416_low_10
Description: NF21416
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21416_low_10 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 327; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 327; E-Value: 0
Query Start/End: Original strand, 1 - 331
Target Start/End: Complemental strand, 23715754 - 23715424
Alignment:
| Q |
1 |
tgatgctaattctgctttgtcaactagttatccataacctagtgaggccccagtgaccctgacacatgaacttgtctggattctgttatattaatcgtaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23715754 |
tgatgctaattctgctttgtcaactagttatccataacctagtgaggccccagtgaccctgacacatgaacttgtctggattctgttatattaatcgtaa |
23715655 |
T |
 |
| Q |
101 |
ggttccttcagtacgggttagtagtgcacaaattattatatcgatgtagacattatcacatgacaaccaataataggccatgcctttccctttcatatgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
23715654 |
ggttccttcagtacgggttagtagtgcacaaattattatatcgatgtagacattatcacatgacaaccaataataggccatgcctttccctttcatattt |
23715555 |
T |
 |
| Q |
201 |
tattgctcattttgttgttacattcagaagcaaataataatacacaatacattttctttatggtcttttagaccttaactaatgagaaaaaagaattttc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23715554 |
tattgctcattttgttgttacattcagaagcaaataataatacacaatacattttctttatggtcttttagaccttaactaatgagaaaaaagaattttc |
23715455 |
T |
 |
| Q |
301 |
tcaaatttaatggatgcagtatactttcatt |
331 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
23715454 |
tcaaatttaatggatgcagtatactttcatt |
23715424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University