View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21416_low_13 (Length: 222)
Name: NF21416_low_13
Description: NF21416
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21416_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 85 - 206
Target Start/End: Original strand, 38959424 - 38959545
Alignment:
| Q |
85 |
caatagctgcagttatggcagcaacaatggctggtgtgagtctttcaagccctagagtaattttcaagggaccagagtctcttcaaaagtctcaggccat |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38959424 |
caatagctgcagttatggcagcaacaatggctggtgtgagtctttcaagccctagagtaattttcaagggaccagagtctcttcaaaagtctcaggccat |
38959523 |
T |
|
| Q |
185 |
caggtccggaccggtgttcatg |
206 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
38959524 |
caggtccggaccggtgttcatg |
38959545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 49; Significance: 3e-19; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 18 - 70
Target Start/End: Complemental strand, 10662330 - 10662278
Alignment:
| Q |
18 |
tatctccccatgttggcaatctctcatttttgataagtctcaaccttgcaaac |
70 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
10662330 |
tatctccccatgttggcaatctctcttttttgataagtctcaaccttgcaaac |
10662278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 7190966 - 7191015
Alignment:
| Q |
18 |
tatctccccatgttggcaatctctcatttttgataagtctcaaccttgca |
67 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| || |||||||||||| |
|
|
| T |
7190966 |
tatctccccatgttggcaatctctcttttttgagaaacctcaaccttgca |
7191015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 18 - 53
Target Start/End: Complemental strand, 10719143 - 10719108
Alignment:
| Q |
18 |
tatctccccatgttggcaatctctcatttttgataa |
53 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |
|
|
| T |
10719143 |
tatctccccatgttggcaatctctcctttttgataa |
10719108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 18 - 70
Target Start/End: Original strand, 10562991 - 10563043
Alignment:
| Q |
18 |
tatctccccatgttggcaatctctcatttttgataagtctcaaccttgcaaac |
70 |
Q |
| |
|
|||||||| |||||||||||||| | |||||||||| |||| |||||| |||| |
|
|
| T |
10562991 |
tatctccctatgttggcaatctcacctttttgataaatctcgaccttggaaac |
10563043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University