View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21416_low_16 (Length: 204)
Name: NF21416_low_16
Description: NF21416
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21416_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 27 - 191
Target Start/End: Original strand, 32954021 - 32954185
Alignment:
| Q |
27 |
tagtaaattctctaatcttttgaatgcctccaaagataaactactctaaaattatcacgtttcacatggtttaggtcttttgtggtgtttgtaattcggt |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32954021 |
tagtaaattctctaatcttttgaatgcctccaaagaaaaactactctaaaattatcacgtttcacatggtttaggtcttttgtggtgtttgtaattcggt |
32954120 |
T |
|
| Q |
127 |
ttgcatcggtttgaataataaaaagtcatctaatataaacattaaaataagacgagttttcttga |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32954121 |
ttgcatcggtttgaataataaaaagtcatctaatataaacattaaaataagacgagttttcttga |
32954185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University