View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21417_high_9 (Length: 342)
Name: NF21417_high_9
Description: NF21417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21417_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 9 - 323
Target Start/End: Complemental strand, 33753029 - 33752715
Alignment:
| Q |
9 |
gagaagcaaaggccagcaatatgtactagtttatttgactgaaaatatcaatgaaaaatttaaagctagaaaattattatatgctttcctggattgtatg |
108 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33753029 |
gagaaacaaaggccagcaatatgtactagtttatttgactgaaaatatcaatgaaaaatttaaagctagaaaattattatatgctttcctggattgtatg |
33752930 |
T |
 |
| Q |
109 |
agcatgagaaatagctcctgagctggcttccaaaatctgagagccacccaatacaccgtcttttccttcttcattaggcttcttggtagctaatgtagcc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33752929 |
agcatgagaaatagctcctgagctggcttccaaaatctgagagccacccaatacaccgtcttttccttcttcattaggcttcttggtagctaatgtagcc |
33752830 |
T |
 |
| Q |
209 |
cggataggacttttcgagaccgcatctgtgacatcagttctaatcgtttttcgaaccggaacacacttgtctgttttgtcttcatctacgaaaactgtat |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33752829 |
cggataggacttttcgagaccgcatctgtgacatcagttctaatcgtttttcgaaccggaacacacttgtctgttttgtcttcatctacgaaaactgtat |
33752730 |
T |
 |
| Q |
309 |
ctctactgtgctttc |
323 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
33752729 |
ctctactgtgctttc |
33752715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University