View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21417_low_12 (Length: 280)
Name: NF21417_low_12
Description: NF21417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21417_low_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 22 - 264
Target Start/End: Complemental strand, 30839873 - 30839638
Alignment:
| Q |
22 |
gtatatgtgtggaaatggtgatagtaggaaagtgggagcaaagagaggtgggaataaaggtactattatgaatgaaagggatgacacgtggtgattcacg |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30839873 |
gtatatgtgtggaaatggtgatagtaggaaagtgggagcaaagagaggtgggaataaaggtactattatgaatgaaagggatgacacgtggtgattcacg |
30839774 |
T |
|
| Q |
122 |
agaccttccctaaccctaaccagatgataaatgccatatggctatggatatggatggatgatattactattcacgccataaccgtttgccttttgccttt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30839773 |
agaccttccctaaccctaaccagatgataaatgccatatggctatggatatggatggatgatattactattcacgccataaccgtttgccttttgc---- |
30839678 |
T |
|
| Q |
222 |
tgcctttaacccaaccaaacaacaccaacagaagctgattcat |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30839677 |
---ctttaacccaaccaaacaacaccaacagaagctgattcat |
30839638 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University