View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21417_low_6 (Length: 417)
Name: NF21417_low_6
Description: NF21417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21417_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-125; HSPs: 7)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-125
Query Start/End: Original strand, 145 - 403
Target Start/End: Original strand, 32952392 - 32952648
Alignment:
| Q |
145 |
ccgaattttcaaatatgacacagcgagaaccgttaacaatgacttacaacacaaagagaagggttatgatggttagcatagttcttgaactgacccctca |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||| |||||| ||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32952392 |
ccgaattttcaaatatgacacagcgagaaccgctaacaatgacttataacacataga--agggttatgatggttagcatagttcttgaactgacccctca |
32952489 |
T |
 |
| Q |
245 |
aattggcccctacattttagaaatgtggggtgaaaaataattgtttgctatgttcatagtttaaataatggtttttgattattattgcttgtaattggat |
344 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
32952490 |
aattggcccctacattttagaaatgtggggtgaaaaataattgtttgctatgttcatagtttaaataatggtttatgattcttattgcttgtaattggat |
32952589 |
T |
 |
| Q |
345 |
attcaggcatctactttaaaaagatatcctgctcaattatcactcactacatggatgtg |
403 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32952590 |
attcaggcatctactttaaaaagatatcctgctcaattatcactcactacatggatgtg |
32952648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 327 - 403
Target Start/End: Original strand, 32935190 - 32935266
Alignment:
| Q |
327 |
tattgcttgtaattggatattcaggcatctactttaaaaagatatcctgctcaattatcactcactacatggatgtg |
403 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32935190 |
tattgcttgtaattggatattcaggcatctactctaaaaagataccctgctcaattatcactcactacatggatgtg |
32935266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 333 - 403
Target Start/End: Original strand, 32884835 - 32884905
Alignment:
| Q |
333 |
ttgtaattggatattcaggcatctactttaaaaagatatcctgctcaattatcactcactacatggatgtg |
403 |
Q |
| |
|
||||||||| | ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32884835 |
ttgtaattgtaaattcaggcatctactctaaaaagatatcctgctcaattatcactcactacatggatgtg |
32884905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 333 - 403
Target Start/End: Complemental strand, 19504188 - 19504118
Alignment:
| Q |
333 |
ttgtaattggatattcaggcatctactttaaaaagatatcctgctcaattatcactcactacatggatgtg |
403 |
Q |
| |
|
||||||||||| ||||||||||| ||| |||||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
19504188 |
ttgtaattggaaattcaggcatcgactctaaaaagataccctgctcaattatcactcacgacatggatgtg |
19504118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 329 - 403
Target Start/End: Original strand, 32895545 - 32895619
Alignment:
| Q |
329 |
ttgcttgtaattggatattcaggcatctactttaaaaagatatcctgctcaattatcactcactacatggatgtg |
403 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| || || ||||||||||||||| ||| |||||| |
|
|
| T |
32895545 |
ttgcttgtaattggatattcaggcatctactctaaaaagatacccagcacaattatcactcactgcattgatgtg |
32895619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 337 - 403
Target Start/End: Original strand, 32918946 - 32919012
Alignment:
| Q |
337 |
aattggatattcaggcatctactttaaaaagatatcctgctcaattatcactcactacatggatgtg |
403 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
32918946 |
aattggatattcaggcatcaactctaaaaagatatccagcacaattatcactcactacatggatgtg |
32919012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 333 - 403
Target Start/End: Original strand, 32881965 - 32882036
Alignment:
| Q |
333 |
ttgtaattggatattcaggcatctactt-taaaaagatatcctgctcaattatcactcactacatggatgtg |
403 |
Q |
| |
|
||||||||||| ||||||||||| ||| ||||||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
32881965 |
ttgtaattggaaattcaggcatccactcataaaaagatatccagctcaattatcactcacttcatggatgtg |
32882036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 178 - 237
Target Start/End: Original strand, 1748250 - 1748309
Alignment:
| Q |
178 |
taacaatgacttacaacacaaagagaagggttatgatggttagcatagttcttgaactga |
237 |
Q |
| |
|
|||||||||||| ||||||||||| | |||||||||||||| ||||||||| |||||| |
|
|
| T |
1748250 |
taacaatgacttgaaacacaaagagtggagttatgatggttagtatagttcttaaactga |
1748309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University