View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21418_high_5 (Length: 378)
Name: NF21418_high_5
Description: NF21418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21418_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 335; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 335; E-Value: 0
Query Start/End: Original strand, 7 - 361
Target Start/End: Original strand, 14177367 - 14177721
Alignment:
| Q |
7 |
tcgaagaatatagtcaatgtctgtggagatgtgttgaagaaaaatattgcttcattgggaccattggttttaccatggagggagcaattcctatatgtcg |
106 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
14177367 |
tcgaagaacatagtcaatgtttgtggagatgtgttgaagaaaaatattgcttcattgggaccattggttttaccatggagggagcaattcttatatgtcg |
14177466 |
T |
 |
| Q |
107 |
tttcaattatttatcacaaactttggagtagaagaagaagaacaagcatatatactccgaaattcaatagggcttttgagcatttctgcatacattcagg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14177467 |
tttcaattatttatcacaaactttggagtagaagaagaagaacaagcatatatactccgaaattcaatagggcttttgagcatttctgcatacattcagg |
14177566 |
T |
 |
| Q |
207 |
aggaagagctgttatacaagccattgagaaaaatttgaagctaaggagagaggatgttgagccatcaaaaatgactctgtacagatttggaaacacttca |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14177567 |
aggaagagctgttatacaagccattgagaaaaatttgaagctaaggagagaggatgttgaaccatcaaaaatgactctgtacagatttggaaacacttca |
14177666 |
T |
 |
| Q |
307 |
tcttcttcaatttggtatgagttgtcatatattgaagcaaaagggaggatgaaat |
361 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
14177667 |
tcttcttcaatttggtatgagttgtcatacattgaagcaaaagggaggatgaaat |
14177721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University