View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21418_high_9 (Length: 235)
Name: NF21418_high_9
Description: NF21418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21418_high_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 60; Significance: 1e-25; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 99 - 158
Target Start/End: Complemental strand, 7257961 - 7257902
Alignment:
| Q |
99 |
ctgtcatctattaattgtggttcatgttgtactaagattgaaattctattataactgtga |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7257961 |
ctgtcatctattaattgtggttcatgttgtactaagattgaaattctattataactgtga |
7257902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 164 - 226
Target Start/End: Complemental strand, 7257862 - 7257800
Alignment:
| Q |
164 |
ttaataatttctcttctgagaggcccttcaattcattccgagattcacctgtttatgatgatg |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7257862 |
ttaataatttctcttctgagaggcccttcagttcattccgagattcacctgtttatgatgatg |
7257800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University