View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2141_low_2 (Length: 327)
Name: NF2141_low_2
Description: NF2141
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2141_low_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 20 - 280
Target Start/End: Original strand, 38634284 - 38634544
Alignment:
| Q |
20 |
aagagcaaagtctggtcaacgctgtggaaaatacgaactgttccgaaacatgcccatctgatttggcgtttacttcatgctcgtcttggagttaaaatgg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38634284 |
aagagcaaagtctggtcaacgctgtggaaaatacgaactgttccgaaacatgcccatctgatttggcgtttacttcatgctcgtcttggagttaaaatgg |
38634383 |
T |
|
| Q |
120 |
ctctttttaataaaggaatcaattgcactccacaatgttgttttcgtgatagtcatattgaaaccattgaacatttattcatggaatgtgaatgggcaca |
219 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38634384 |
ctctttttaataaaggaatcaattgcaatccacaatgtagttttcgtgatagtcatattgaaaccattgaacatttattcatggaatgtaaatgggcaca |
38634483 |
T |
|
| Q |
220 |
gtctgtgtggtttgtgtctccgttgggcgtcaatttttctagcaccactgctcctgctaaa |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38634484 |
gtctgtgtggtttgtgtctccgttgggcgtcaatttttctagcaccactgctcctgctaaa |
38634544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University