View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21422_high_4 (Length: 329)
Name: NF21422_high_4
Description: NF21422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21422_high_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 13 - 313
Target Start/End: Complemental strand, 44627301 - 44626998
Alignment:
| Q |
13 |
aaaatcggaatattcaggatcccctataaacacatggattggtttctcatttgtgaatggtttaattataagtggaaaagggactgttgatggtcgaggc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44627301 |
aaaatcggaatattcaggatcccctataaacacatggattggtttctcatttgtgaatggtttaattataagtggaaaagggactgttgatggtcgaggc |
44627202 |
T |
 |
| Q |
113 |
tctatgtggtggaaacaaccttgcataggaaatccaccacccgtaagtactatagnnnnnnnnaacttaataacatttcaacttgtgttacttaaataat |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
44627201 |
tctatgtggtggaaacaaccttgcataggaaatccaccacccgtaagtactatag-tttttttaacttaataacatttcaacttttgttacttaaataat |
44627103 |
T |
 |
| Q |
213 |
acactatatatactttttatagta----atatatacttgcatcatttttatgannnnnnnncttccctttttcaggggacaagttgccgtccaccaacag |
308 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44627102 |
acactatatatatcttttatagtaatatatatatacttgcatcatttttatgattttttttcttccctttttcaggggacaagttgccgtccaccaacag |
44627003 |
T |
 |
| Q |
309 |
taagt |
313 |
Q |
| |
|
||||| |
|
|
| T |
44627002 |
taagt |
44626998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University