View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21422_low_6 (Length: 314)
Name: NF21422_low_6
Description: NF21422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21422_low_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 1 - 298
Target Start/End: Original strand, 26049908 - 26050206
Alignment:
| Q |
1 |
gacgagttggcaattgcacttcttgataaggtgttgctaatttgatatggatttgaatcttctggttttaacacttgacatgacttttgctgcattggtg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
26049908 |
gacgagttggcaattgcacttcttgataaggtgttgctaatttgatatggatttgaatcttctggttttaacactggacatgacttttgctgcattggtg |
26050007 |
T |
 |
| Q |
101 |
ggttctgattctatattc-gacaaccagggagaattcaaacccgtgctgataaattggtggatatttctcatgcaaatcttttgatgtatggtagatttg |
199 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
26050008 |
ggttctgatcctatattccgacaaccagggagaattcaaacccgtgctgataaattgatggatatttctcatgcaaatcgtttgatgtatggtagatttg |
26050107 |
T |
 |
| Q |
200 |
aatgctgcacaatagcttgtacattgacttgaatatttctattattttttgtttatcaaatcctgtttttatgtctatgattagaattataatatatat |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26050108 |
aatgctgcacaatagcttgtacattgacttgaatatttctattattttttgttaatcaaatcctgtttttatgtctatgattagaattataatatatat |
26050206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University