View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21423_high_14 (Length: 295)
Name: NF21423_high_14
Description: NF21423
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21423_high_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 133; Significance: 3e-69; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 123 - 267
Target Start/End: Original strand, 32628143 - 32628286
Alignment:
| Q |
123 |
aagatcataatatcaagatccttaataaagtttgcttacaagttaaagttcaaaaatcccttccaatgtgatgcattttggtggggacatgaaggttctc |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32628143 |
aagatcataatatcaagatccttaataaagtttgcttacaagttaaagttcaaaa-tcccttccaatgtgatgcattttggtggggacatggaggttctc |
32628241 |
T |
 |
| Q |
223 |
caagatgtgggttgcatttgatgtgtattggagtcaaagatctcg |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32628242 |
caagatgtgggttgcatttgatgtgtattggagtcaaagatctcg |
32628286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 10 - 49
Target Start/End: Original strand, 32628102 - 32628143
Alignment:
| Q |
10 |
atgaaaagacagag--gcgaaaatagttccattaaaaatcaa |
49 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
32628102 |
atgaaaagacagagaggcgaaaatagttccattaaaaatcaa |
32628143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University