View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21423_high_22 (Length: 244)
Name: NF21423_high_22
Description: NF21423
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21423_high_22 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 229; Significance: 1e-126; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 8 - 244
Target Start/End: Complemental strand, 14929142 - 14928906
Alignment:
| Q |
8 |
gaaatgaagatcaatatgattagcacaaataatagcagtaatgatagcccaataaacagcaacaggaatctcttgcatagcttcagacaaagcaggaaca |
107 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14929142 |
gaaaagaagatcaagatgattagcacaaataatagcagtaatgatagcccaataaacagcaacaggaatctcttgcatagcttcagacaaagcaggaaca |
14929043 |
T |
 |
| Q |
108 |
tctttatgttcatacccttttgttgaaagcttttccaactcagtaatacactcaacagcaaacaacagattcttcaccaaactgttgtaatcagcaatgg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14929042 |
tctttatgttcatacccttttgttgaaagcttttccaactcagtaatacactcaacagcaaacaacagattcttcaccaaactgttgtaatcagcaatgg |
14928943 |
T |
 |
| Q |
208 |
cttgtctattcttatcgacactttgaacacggttcat |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14928942 |
cttgtctattcttatcgacactttgaacacggttcat |
14928906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 56 - 109
Target Start/End: Complemental strand, 33237348 - 33237295
Alignment:
| Q |
56 |
ccaataaacagcaacaggaatctcttgcatagcttcagacaaagcaggaacatc |
109 |
Q |
| |
|
||||||||||||||||||||| ||||||| || |||||||||| ||||||||| |
|
|
| T |
33237348 |
ccaataaacagcaacaggaatatcttgcaatgcatcagacaaagaaggaacatc |
33237295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University