View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21423_low_17 (Length: 276)
Name: NF21423_low_17
Description: NF21423
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21423_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 266
Target Start/End: Original strand, 37305653 - 37305918
Alignment:
| Q |
1 |
ctaataatatcaccttaaaatatagttttgtacatgattgttattattctgcccaataacgatgatttagattttgtgcaatgtgtctgcgcacaatcag |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||||||||||||||| |||| ||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
37305653 |
ctaataatatcaccttaaaatatatttttgtacctgattgttattattctggtcaatgacgatgattcagattttgtgcaatttgtctgcgcacaatcag |
37305752 |
T |
|
| Q |
101 |
tcaagtctataccatgcaatcaagatcgaacgattcaaatttcaataattttatttgtttaaatttaaaatactgactttgaaatatagattgtctcgag |
200 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | |
|
|
| T |
37305753 |
tcaagtctataccattcaatcaagatcgaacgattcaaatttcaataattttatttgtttaaatttaaaatactgaccttgaaatatagattgtctcggg |
37305852 |
T |
|
| Q |
201 |
acaatctagatatagctaactacatgcattgacaaggttgtaacaccgcaaaacctaaatcctatg |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
37305853 |
acaatctagatatagctaactacatgcattgacgaggatgtaacaccgcaaaacctaaatcctatg |
37305918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University