View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21423_low_23 (Length: 241)
Name: NF21423_low_23
Description: NF21423
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21423_low_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 119; Significance: 6e-61; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 108 - 226
Target Start/End: Complemental strand, 36236221 - 36236103
Alignment:
| Q |
108 |
ctttttcttttggtgtatgtttgatatttaccaacacttgaatgttttaaaaagcttttgtgaattttgaggccttaagaaagcaactcaaatgatttaa |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36236221 |
ctttttcttttggtgtatgtttgatatttaccaacacttgaatgttttaaaaagcttttgtgaattttgaggccttaagaaagcaactcaaatgatttaa |
36236122 |
T |
 |
| Q |
208 |
tatgatttcaagatggtta |
226 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
36236121 |
tatgatttcaagatggtta |
36236103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 3 - 44
Target Start/End: Complemental strand, 36236326 - 36236285
Alignment:
| Q |
3 |
ttcaagatcaacctcagattaaaactcataatcaaagccctt |
44 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36236326 |
ttcaagatcaacctcagattaaaactcataatcaaagccctt |
36236285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University