View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21424_low_6 (Length: 287)

Name: NF21424_low_6
Description: NF21424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21424_low_6
NF21424_low_6
[»] chr1 (1 HSPs)
chr1 (33-156)||(52734457-52734580)


Alignment Details
Target: chr1 (Bit Score: 96; Significance: 4e-47; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 33 - 156
Target Start/End: Original strand, 52734457 - 52734580
Alignment:
33 agttgttcgtatatccttaggtttcattacttttgcaggctaggaatcaaaaggttggggagaaacctcttctctctatttctacattcatgcaggtact 132  Q
    |||| ||| |||||||| | |||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||    
52734457 agtttttcttatatcctaatgtttcattacttttgcaggctaggaatcaaaaggttggtgataaacctcttctctctatttctacattcatgcaggtact 52734556  T
133 atattaatcattcctatggaatat 156  Q
    |||||||||||| |||||||||||    
52734557 atattaatcatttctatggaatat 52734580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University