View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21424_low_6 (Length: 287)
Name: NF21424_low_6
Description: NF21424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21424_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 96; Significance: 4e-47; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 33 - 156
Target Start/End: Original strand, 52734457 - 52734580
Alignment:
| Q |
33 |
agttgttcgtatatccttaggtttcattacttttgcaggctaggaatcaaaaggttggggagaaacctcttctctctatttctacattcatgcaggtact |
132 |
Q |
| |
|
|||| ||| |||||||| | |||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52734457 |
agtttttcttatatcctaatgtttcattacttttgcaggctaggaatcaaaaggttggtgataaacctcttctctctatttctacattcatgcaggtact |
52734556 |
T |
 |
| Q |
133 |
atattaatcattcctatggaatat |
156 |
Q |
| |
|
|||||||||||| ||||||||||| |
|
|
| T |
52734557 |
atattaatcatttctatggaatat |
52734580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University