View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21425_high_4 (Length: 286)
Name: NF21425_high_4
Description: NF21425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21425_high_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 4 - 241
Target Start/End: Complemental strand, 35744097 - 35743860
Alignment:
| Q |
4 |
aacagaggtagcgtcaggggcggtcaatgtctttttcaaatatagaggggaggtgagtgatatttggttagaactagaggaggttaatgtaatttttcca |
103 |
Q |
| |
|
||||||||||| || ||||| ||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35744097 |
aacagaggtagtgtgaggggaggtcaatgtctttttaaaaaatagaggggaggtgagtgatatttggttagaactagaggaggttaatgtaatttttcca |
35743998 |
T |
|
| Q |
104 |
aataataaacataaaaatctagacttcggcgcaagttgtgccaaaacatccacccttgaattaatcctatggttaagagcatgctcaacatgcaaattat |
203 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
35743997 |
aataataaacataaaaagctagacttcggcacaagttgtgccaaaacatccacccttgaattaatcctatggttaagagcatgttcaacatgaaaattat |
35743898 |
T |
|
| Q |
204 |
tagatgggtccttctttaagtggtaacccacatcaatt |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35743897 |
tagatgggtccttctttaagtggtaacccacatcaatt |
35743860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 19 - 78
Target Start/End: Complemental strand, 45512330 - 45512271
Alignment:
| Q |
19 |
aggggcggtcaatgtctttttcaaatatagaggggaggtgagtgatatttggttagaact |
78 |
Q |
| |
|
||||| |||||| ||||||| ||| ||||||||||||||||||| | |||||||||||| |
|
|
| T |
45512330 |
aggggaggtcaaagtcttttgaaaaaatagaggggaggtgagtgacacttggttagaact |
45512271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University