View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21425_low_6 (Length: 239)
Name: NF21425_low_6
Description: NF21425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21425_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 7)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 33750405 - 33750187
Alignment:
| Q |
1 |
ttttttctcttctgggaagaaatcgcatcctaagcatcctgcaatgttgcattcctggcaggtttccatgttcgcaggtggaacaattctttctaannnn |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33750405 |
ttttttctcttctgggaagaaatcgcatcctaagcatcctgcaatgttgcattcctggcaggtttctatgttcgcaggtggaacaattctttctaagctg |
33750306 |
T |
 |
| Q |
101 |
nnnnnnnnnnnnnntccgatggcgggatttgggaggtgaaattcggtggaggtggagccggagacgacattggttaaggcagagacgatgacagagagtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33750305 |
ctgctgctgctgcttccgatggcgggatttgggaggtgaaattcggtggaggtggagccggagacgacattggttaaggcagagacgatgacagagagtt |
33750206 |
T |
 |
| Q |
201 |
cttgatcggaagtgagtgt |
219 |
Q |
| |
|
|||||||||| |||||||| |
|
|
| T |
33750205 |
cttgatcggaggtgagtgt |
33750187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 144 - 222
Target Start/End: Complemental strand, 33720835 - 33720757
Alignment:
| Q |
144 |
cggtggaggtggagccggagacgacattggttaaggcagagacgatgacagagagttcttgatcggaagtgagtgtggt |
222 |
Q |
| |
|
||||||||||||| |||||||| || ||||||| ||||| ||||||||| ||||||||||||||||| ||||| ||||| |
|
|
| T |
33720835 |
cggtggaggtggaaccggagactacgttggttagggcagcgacgatgactgagagttcttgatcggaggtgagggtggt |
33720757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 33720936 - 33720864
Alignment:
| Q |
1 |
ttttttctcttctgggaagaaatcgcatcctaagcatcctgcaatgttgcattcctggcaggtttccatgttc |
73 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||| |||||||| |||||||||||| | |||||||| |||||| |
|
|
| T |
33720936 |
ttttttctcttcagggaagaaattgcatcctaaacatcctgctatgttgcattcccgacaggtttctatgttc |
33720864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 144 - 216
Target Start/End: Complemental strand, 33735444 - 33735372
Alignment:
| Q |
144 |
cggtggaggtggagccggagacgacattggttaaggcagagacgatgacagagagttcttgatcggaagtgag |
216 |
Q |
| |
|
|||||||||||||||||||||| || |||||||| |||| |||||| | ||||||||||||||||| ||||| |
|
|
| T |
33735444 |
cggtggaggtggagccggagactacgttggttaaagcagcaacgatggcggagagttcttgatcggaggtgag |
33735372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 16 - 83
Target Start/End: Complemental strand, 33718917 - 33718850
Alignment:
| Q |
16 |
gaagaaatcgcatcctaagcatcctgcaatgttgcattcctggcaggtttccatgttcgcaggtggaa |
83 |
Q |
| |
|
|||||||| ||||||||| |||||||| ||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
33718917 |
gaagaaattgcatcctaaacatcctgctatgttgcattcgcggcaggtttccatgttcgttggtggaa |
33718850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 33735599 - 33735540
Alignment:
| Q |
1 |
ttttttctcttctgggaagaaatcgcatcctaagcatcctgcaatgttgcattcctggca |
60 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||| |||||||| |||||||||||| |||| |
|
|
| T |
33735599 |
ttttttctcttcagggaagaaattgcatcctaaacatcctgctatgttgcattcccggca |
33735540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 144 - 210
Target Start/End: Complemental strand, 33718783 - 33718717
Alignment:
| Q |
144 |
cggtggaggtggagccggagacgacattggttaaggcagagacgatgacagagagttcttgatcgga |
210 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||| ||| | ||| ||||| || ||||||||||||| |
|
|
| T |
33718783 |
cggttgaggtggagccggagacgactttggttagggcggtgacaatgacggattgttcttgatcgga |
33718717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University