View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21426_low_4 (Length: 251)
Name: NF21426_low_4
Description: NF21426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21426_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 1 - 97
Target Start/End: Original strand, 33887346 - 33887442
Alignment:
| Q |
1 |
ttacctgaacgattttaaattgtggttggttttgtctaccgtttcaaaacacttagttttcagctgcaagatcatcacagtaattcacaaatattag |
97 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33887346 |
ttacctgaacgattttaaattgtggttcgttttgtctaccgtttcaaaacacttagttttcagctgcaagatcatcacagtaattcacaaatattag |
33887442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 164 - 233
Target Start/End: Original strand, 33887493 - 33887562
Alignment:
| Q |
164 |
ctgaagaattggaaaagggaaactcatttcgagaatacagaattttgagaaacaaacctctggatctaac |
233 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33887493 |
ctgaggaattggaaaagggaaactcatttcgagaatacagaattttgagaaacaaacctctggatctaac |
33887562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University