View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21428_high_3 (Length: 457)
Name: NF21428_high_3
Description: NF21428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21428_high_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 1e-82; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 1e-82
Query Start/End: Original strand, 72 - 231
Target Start/End: Original strand, 32496693 - 32496852
Alignment:
| Q |
72 |
aaaatgagtagtagagttacctcttggacgaaaagtttattaggtgttaactgaattccattaagagaaccaaattcatcagacccagaagtacaacggg |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32496693 |
aaaatgagtagtagagttacctcttggacgaaaagtttattaggtgttaactgaattccattaagacaaccaaattcatcagacccagaagtacaacggg |
32496792 |
T |
 |
| Q |
172 |
taattaaccgattcttaaccaaccccaaccgcttaaatttctgtaaaaacaatatcaagt |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32496793 |
taattaaccgattcttaaccaaccccaaccgcttaaatttctgtaaaaacaatatcaagt |
32496852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 360 - 450
Target Start/End: Original strand, 32496981 - 32497071
Alignment:
| Q |
360 |
tggctctgcagttggagaaagtagtggagttcattgttgttcgtcacgcaacaacgttgttgttacggagagaagtagaagatgatgatgt |
450 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32496981 |
tggctctgcagttggagaaagtagtggagttcattgttgttcgacacgcaacaacgttgttgttacggagagaagtagaagatgatgatgt |
32497071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 41 - 75
Target Start/End: Original strand, 32496648 - 32496682
Alignment:
| Q |
41 |
taacatgaatttgaacactaaaataaagtttaaaa |
75 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
32496648 |
taacatgaatttgaacactaaaataaagtttaaaa |
32496682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University