View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21428_low_14 (Length: 344)
Name: NF21428_low_14
Description: NF21428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21428_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 1 - 334
Target Start/End: Complemental strand, 41403829 - 41403496
Alignment:
| Q |
1 |
cttttttggagcctgagttccagctagcaacttttcccccttgggaaagtgccaaatttcagtttgcttggaccggaaggtactagagctaatgtttttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41403829 |
cttttttggagcctgagttccagctagcaacttttcccccttgggaaagtgccaaatttcagtttgcttggaccggaaggtactagagctaatgtttttc |
41403730 |
T |
 |
| Q |
101 |
accttagaaggcgcagttaaaggaaatgatcctgattttgtcaatttcgctttattgtgaggagtttgatgaannnnnnnaccaccaatgtctatatctc |
200 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
41403729 |
accttagaaggcgcggttaaaggaaatgatcctgattttgtcaatttcgctttattgtgaggagtttgatgaatttttttaccaccaatgtctatatctc |
41403630 |
T |
 |
| Q |
201 |
ttagaaatttgagtaatgcatttttctccacattaattacctccaaaacatcatcattgtttttgaatttaattgaaatgtctctgttaagggaaccttg |
300 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41403629 |
ttagaaatttgagtaatgcattcttctccacattaattacctccaaaacatcatcattgtttttgaatttaattgaaatgtctctgttaagggaaccttg |
41403530 |
T |
 |
| Q |
301 |
atccgttgttgtcttgacatctttcttctgatga |
334 |
Q |
| |
|
||| |||||||| ||||||||||||||||||||| |
|
|
| T |
41403529 |
atctgttgttgtattgacatctttcttctgatga |
41403496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University