View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21428_low_17 (Length: 285)
Name: NF21428_low_17
Description: NF21428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21428_low_17 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 97; Significance: 1e-47; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 18 - 144
Target Start/End: Complemental strand, 2305215 - 2305090
Alignment:
| Q |
18 |
acatacaacatataaatggagattaaaagttaagtgagaaaacnnnnnnngcttattatatttaatatgtttatgtggtgtaggtaacattaattatggc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2305215 |
acatacaacatataaatggagattaaaagttaagtaagaaaacaaaaaa-gcttattatatttaatatgtttatgtggtgtaggtaacattaattatggc |
2305117 |
T |
 |
| Q |
118 |
aaacttatatttatagtcctttaacgg |
144 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
2305116 |
aaacttatatttatagtcctttaacgg |
2305090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 176 - 217
Target Start/End: Complemental strand, 2305052 - 2305011
Alignment:
| Q |
176 |
tacatatgaattatattaaatatcaattttaaaattcatatc |
217 |
Q |
| |
|
||||||||||||||||||| | |||||| ||||||||||||| |
|
|
| T |
2305052 |
tacatatgaattatattaagtgtcaattctaaaattcatatc |
2305011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University