View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21429_high_6 (Length: 288)
Name: NF21429_high_6
Description: NF21429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21429_high_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 1 - 279
Target Start/End: Complemental strand, 4059156 - 4058871
Alignment:
| Q |
1 |
ccacccttactcatgcttaccaattgcttaagctcgatttagtga----aattaatggattaactcttttatcggggaaaatagtagcaaaatgagttag |
96 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4059156 |
ccacccttactcttgcttaccaattgcttaagctcgatttagtgagtgaaattaatggattaactcttttatcggggaaaatagtagcaaaatgagttag |
4059057 |
T |
 |
| Q |
97 |
aaacatatacactgtttgattttaagttatattatatggtcataactgccgtgttatgtattgattgaatttcatgttgatatatcat---ataactttc |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4059056 |
aaacatatacactgtttgattttaagttatattatatggtcataactgccgtgttatgtattgattgaatttcatgttgatatatcatataataactttc |
4058957 |
T |
 |
| Q |
194 |
atacttgactatattgtgcttaagtgaaatatttgttgtttgcttcttaagtgaaatgattgacatagtatgatatatgaatcatt |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4058956 |
atacttgactatattgtgcttaagtgaaatatttgttgtttgcttcttaagtgaaatgattgacatagtatgatatatgaatcatt |
4058871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University