View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21429_low_8 (Length: 255)

Name: NF21429_low_8
Description: NF21429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21429_low_8
NF21429_low_8
[»] chr4 (1 HSPs)
chr4 (195-244)||(47430134-47430183)


Alignment Details
Target: chr4 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 195 - 244
Target Start/End: Original strand, 47430134 - 47430183
Alignment:
195 atgtttttattaaaaaaccgtctttatttgatttccctctctttctctct 244  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||    
47430134 atgtttttattaaaaaactgtctttatttgatttccctctctttctctct 47430183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University