View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2142_high_23 (Length: 232)

Name: NF2142_high_23
Description: NF2142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2142_high_23
NF2142_high_23
[»] chr5 (1 HSPs)
chr5 (155-217)||(30256215-30256277)


Alignment Details
Target: chr5 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 155 - 217
Target Start/End: Original strand, 30256215 - 30256277
Alignment:
155 acacaattgttatgattcttttgtatcaagaattttctttgtttctctgcttatgatcctttg 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
30256215 acacaattgttatgattcttttgtatcaagaattttctttgtttctctgtttatgatcctttg 30256277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University