View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2142_high_26 (Length: 204)
Name: NF2142_high_26
Description: NF2142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2142_high_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 59; Significance: 3e-25; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 125 - 187
Target Start/End: Original strand, 34731813 - 34731875
Alignment:
| Q |
125 |
ctcactttacaagttaaaagagattattacttgtcagaaaatctgattagtgaagttactagt |
187 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
34731813 |
ctcactttacaagttaaaagagattattccttgtcagaaaatctgattagtgaagttactagt |
34731875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 17 - 65
Target Start/End: Original strand, 34731736 - 34731784
Alignment:
| Q |
17 |
acacacaccaaacgcagataaaagagatctcaaacttgttttggggata |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34731736 |
acacacaccaaacgcagataaaagagatctcaaacttgttttgaggata |
34731784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University