View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2142_low_10 (Length: 306)
Name: NF2142_low_10
Description: NF2142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2142_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 110 - 299
Target Start/End: Complemental strand, 29191462 - 29191273
Alignment:
| Q |
110 |
gtaagctaattagaaaatgacctgcatcgaagtaaaacttgaacattggtttctttatctttgttatcctgacggttagggttccgatcagagccacgtg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29191462 |
gtaagctaattagaaaatgacctgcatcgaagtaaaacttgaacattggtttctttatctttgttatcctgacggttagggttccgatcagagccacgtg |
29191363 |
T |
|
| Q |
210 |
aatcgggacgacggcgttcgggtcgaggtgttagaaatggagctggagatgggattgtcatccctaaccctactttcttagagtgatctg |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29191362 |
aatcgggacgacggcgttcgggtcgaggtgttagaaatggagctggagatgggattgtcatccctaaccctactttcttagagtgatctg |
29191273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 35
Target Start/End: Complemental strand, 29191570 - 29191536
Alignment:
| Q |
1 |
aacattcgatcgttgttcttcatcgcttaatggcc |
35 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
29191570 |
aacattcgatcgttgttcttcatcgcttaatggcc |
29191536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University