View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2142_low_13 (Length: 255)
Name: NF2142_low_13
Description: NF2142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2142_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 43 - 115
Target Start/End: Complemental strand, 9689790 - 9689718
Alignment:
| Q |
43 |
aaatagttaggataaataaaataaaaagttgtgcataagtaaatgattatttactcaggatcaaaggttaact |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
9689790 |
aaatagttaggataaataaaataaaaagttgtgcataagtaaatgattatttactctggatcaaatgttaact |
9689718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University