View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2142_low_13 (Length: 255)

Name: NF2142_low_13
Description: NF2142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2142_low_13
NF2142_low_13
[»] chr8 (1 HSPs)
chr8 (43-115)||(9689718-9689790)


Alignment Details
Target: chr8 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 43 - 115
Target Start/End: Complemental strand, 9689790 - 9689718
Alignment:
43 aaatagttaggataaataaaataaaaagttgtgcataagtaaatgattatttactcaggatcaaaggttaact 115  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||    
9689790 aaatagttaggataaataaaataaaaagttgtgcataagtaaatgattatttactctggatcaaatgttaact 9689718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University