View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2142_low_22 (Length: 238)
Name: NF2142_low_22
Description: NF2142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2142_low_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 102 - 229
Target Start/End: Complemental strand, 45080737 - 45080609
Alignment:
| Q |
102 |
gtatacatgcccatgactaacaatttatattcctcaacaaaacatannnnnnnn-catttatcagccaaaacaatttgatatttaatacttgtatattaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
45080737 |
gtatacatgcccatgactaacaatttatattcctcaacaaaacataattttttttcatttatcaaccaaaacaatttgatatttaatacttatatattaa |
45080638 |
T |
 |
| Q |
201 |
gtaaaaatctcaatatggtatagaataat |
229 |
Q |
| |
|
|||||||||||||||| |||||||||||| |
|
|
| T |
45080637 |
gtaaaaatctcaatatagtatagaataat |
45080609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University