View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2142_low_23 (Length: 232)
Name: NF2142_low_23
Description: NF2142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2142_low_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 155 - 217
Target Start/End: Original strand, 30256215 - 30256277
Alignment:
| Q |
155 |
acacaattgttatgattcttttgtatcaagaattttctttgtttctctgcttatgatcctttg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
30256215 |
acacaattgttatgattcttttgtatcaagaattttctttgtttctctgtttatgatcctttg |
30256277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University