View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2142_low_26 (Length: 204)

Name: NF2142_low_26
Description: NF2142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2142_low_26
NF2142_low_26
[»] chr1 (2 HSPs)
chr1 (125-187)||(34731813-34731875)
chr1 (17-65)||(34731736-34731784)


Alignment Details
Target: chr1 (Bit Score: 59; Significance: 3e-25; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 125 - 187
Target Start/End: Original strand, 34731813 - 34731875
Alignment:
125 ctcactttacaagttaaaagagattattacttgtcagaaaatctgattagtgaagttactagt 187  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
34731813 ctcactttacaagttaaaagagattattccttgtcagaaaatctgattagtgaagttactagt 34731875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 17 - 65
Target Start/End: Original strand, 34731736 - 34731784
Alignment:
17 acacacaccaaacgcagataaaagagatctcaaacttgttttggggata 65  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||    
34731736 acacacaccaaacgcagataaaagagatctcaaacttgttttgaggata 34731784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University