View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2142_low_9 (Length: 329)
Name: NF2142_low_9
Description: NF2142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2142_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 183 - 317
Target Start/End: Original strand, 8177035 - 8177169
Alignment:
| Q |
183 |
cctttctgagcataccctctttatggaaccctaccttttccaacaccctttgagaagctatgttctgtagaacagtataagcttgcaaccttctcaaatc |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8177035 |
cctttctgagcataccctctttatggaaccctaccttttccaacaccctctgagaagctatgttctgtagaacagtataagcttgcaaccttctcaaatc |
8177134 |
T |
 |
| Q |
283 |
tgggaactcatggaacacttttgacagaataatct |
317 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
8177135 |
tgggaactcatggaacacttttgacagaagaatct |
8177169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 17 - 131
Target Start/End: Original strand, 8176868 - 8176983
Alignment:
| Q |
17 |
tgatctctctcatttataaagaggtgcaatttattttaaaacttaaaactgatattcctataacaccaaatacaact-aaatactaactaaacaacagag |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8176868 |
tgatctctctcatttataaagaggtgcaatttattttaaaacttaaaactgatattcctataacaccaaatacaactaaaatactaactaaacaacagag |
8176967 |
T |
 |
| Q |
116 |
ggaatttcatctgtcc |
131 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
8176968 |
ggaatttcatctgtcc |
8176983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 184 - 241
Target Start/End: Original strand, 25503279 - 25503336
Alignment:
| Q |
184 |
ctttctgagcataccctctttatggaaccctaccttttccaacaccctttgagaagct |
241 |
Q |
| |
|
||||||||| |||||||| || ||||||| ||||||||||| ||||| ||||||||| |
|
|
| T |
25503279 |
ctttctgagtataccctccctaaggaacccaaccttttccaagaccctctgagaagct |
25503336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University