View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21430_low_18 (Length: 352)
Name: NF21430_low_18
Description: NF21430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21430_low_18 |
 |  |
|
| [»] scaffold0062 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0062 (Bit Score: 317; Significance: 1e-179; HSPs: 1)
Name: scaffold0062
Description:
Target: scaffold0062; HSP #1
Raw Score: 317; E-Value: 1e-179
Query Start/End: Original strand, 20 - 340
Target Start/End: Complemental strand, 5953 - 5633
Alignment:
| Q |
20 |
tgcagccagcaatgaagatctcccttggcatcttaataatcttatctgcaggctcggtgtcacccgggtcggtgctaattcctggaaggaatttttcagg |
119 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5953 |
tgcatccagcaatgaagatctcccttggcatcttaataatcttatctgcaggctcggtgtcacccgggtcggtgctaattcctggaaggaatttttcagg |
5854 |
T |
 |
| Q |
120 |
agagtagtcattcgctatctttgaataaagtttcacaaattcttcagatgtttgtacaattttagtttggttgtataacttgtagtcaaccaaattaata |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5853 |
agagtagtcattcgctatctttgaataaagtttcacaaattcttcagatgtttgtacaattttagtttggttgtataacttgtagtcaaccaaattaata |
5754 |
T |
 |
| Q |
220 |
ttgtccttgttttcccaatacaatttgcggtaatgcgaatcattttgctcggatggagcaatggacacaacattgatattcagatctctatctttcttga |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5753 |
ttgtccttgttttcccaatacaatttgcggtaatgcgaatcattttgctcggatggagcaatggacacaacattgatattcagatctctatctttcttga |
5654 |
T |
 |
| Q |
320 |
gatctgttataacttgcccta |
340 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
5653 |
gatctgttataacttgcccta |
5633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University