View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21430_low_19 (Length: 325)
Name: NF21430_low_19
Description: NF21430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21430_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 14 - 308
Target Start/End: Complemental strand, 48014572 - 48014278
Alignment:
| Q |
14 |
gagatgaatccaatataaaagttgagtggatagccagagggtcctaattcggctcagagcgatgcattgtggttacattgtgcatccatgatgactcgag |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
48014572 |
gagatgaatccaatataaaagttgagtggatagccagagggtcctaattcggctcagagcgatacattgtggttacattgtgcatccatgatgactcgag |
48014473 |
T |
 |
| Q |
114 |
catcactgtgcagattggaccatgttgtcttgttgggtgaggccatgaattagttcaaaacacttaaatatgtgagatgtttttattgagccactttggt |
213 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
48014472 |
catcattgtgcatattggaccatgttgtcttgttgggtgaggccatgaattagttcaaaacacttaaatatgtgagatgtttttattgagccactttgat |
48014373 |
T |
 |
| Q |
214 |
aataaaaaagtttaggcgagttggcattcatagattgacatatatcaggatttgtcgtaacactcaacaagtgacaacaaatgtatttacaaatt |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48014372 |
aataaaaaagtttaggcgagttggcattcatagattgacatatatcaggatttgtcttaacactcaacaagtgacaacaaatgtatttacaaatt |
48014278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University