View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21430_low_22 (Length: 296)
Name: NF21430_low_22
Description: NF21430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21430_low_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 102; Significance: 1e-50; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 163 - 289
Target Start/End: Complemental strand, 19504413 - 19504287
Alignment:
| Q |
163 |
accttcatctttctaaacgatcatcatcttaaattgtatgttcatggaggttcctagtttcttaccaaacattagtaatttcattgacatgtcttatgtt |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19504413 |
accttcatctttctaaacgatcatcatcttaaattgtatgttcatggaggttcctagtttctaaccaaacattagtaatttcattgacatgtcttatgtt |
19504314 |
T |
 |
| Q |
263 |
cnnnnnnntctaaactagtcacctttg |
289 |
Q |
| |
|
| ||||||||||||||||||| |
|
|
| T |
19504313 |
caaaaaaatctaaactagtcacctttg |
19504287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 17 - 88
Target Start/End: Complemental strand, 19504520 - 19504447
Alignment:
| Q |
17 |
aattaatgatattggttcttaac--cgtccattgagcttcttctttaaagtaaacattcgtttgttcacaaccc |
88 |
Q |
| |
|
||||||| ||||||||||||||| ||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19504520 |
aattaataatattggttcttaacaccgttcattgatcttcttctttaaagtaaacattcgtttgttcacaaccc |
19504447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University