View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21430_low_23 (Length: 296)
Name: NF21430_low_23
Description: NF21430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21430_low_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 16 - 283
Target Start/End: Complemental strand, 44049590 - 44049323
Alignment:
| Q |
16 |
acagaagaggtttgtgaagtactaggaaactcacaaaaactagtacatgaaattgttcaagttgtttttaacaaaaactatgataaagtttctgaggctg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44049590 |
acagaagaggtttgtgaagtactaggaaattcacaaaaactagtacatgaaattgttcaagttgtttttaacaaaaactatgataaagtttctgaggctg |
44049491 |
T |
 |
| Q |
116 |
caattaaggccttatcagcattatgttcattggaatcaaacaaagagagtctagtgaaaggaggagcaataaatggaatcataacatatatttcaagatg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44049490 |
caattaaggccttatcagcattatgttcattggaatcaaacaaagagagtctagtgaaaggaggagcaataaatggaatcataacatatatttcaagatg |
44049391 |
T |
 |
| Q |
216 |
tgaaaatagacagaagaatttggctccactagcaatggcaacaatgaagaaacttttggtgttagaga |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44049390 |
tgaaaatagacagaagaatttggctccactagcaatggcaacaatgaagaaacttttggtgttagaga |
44049323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University